Skip to main content

Table 2 Probe and primer sequences for NPY and WIF1 genes

From: The detection of specific hypermethylated WIF1 and NPY genes in circulating DNA by crystal digital PCR™ is a powerful new tool for colorectal cancer diagnosis and screening

Gene Oligo type Sequence Fluorophore Tm (°C)
NPY Forward primer 5′ CGCGGCGAGGAAGTTTTATA 3′ / 58
Reverse primer 5′ ATACTATCGAACGAACGTCTCCG 3′ / 64
Probe 5′ CGCGATTCGTTTTTTGTA 3’ Cyanine 5 47.8
WIF1 Forward primer 5′ GAGGGAGTTGTAGCGTAGTAGAGTATTTG 3’ / 58
Reverse primer 5′ AAAACTCCTCGTACCGCACCTA 3’ / 54
Probe 5′ CGGCGTTAGGTTGC 3’ Cyanine 3 56