Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Oncogenic role of ALX3 in cervical cancer cells through KDM2B-mediated histone demethylation of CDC25A

Gene Primer sequence (5′-3′)
CDC25A F: TCTGGACAGCTCCTCTCGTCAT
R: ACTTCCAGGTGGAGACTCCTCT
ALX3 F: GGAGAAGGTCTTCCAGAAAACCC
R: ACTTGGCTCTGCGGTTCTGGAA
KDM2B F: CATGGAGTGCTCCATCTGCAATG
R: ACTTCGGACACTCCCAGCAGTT
GAPDH F: GTCTCCTCTGACTTCAACAGCG
R: ACCACCCTGTTGCTGTAGCCAA
  1. RT-qPCR reverse transcription-quantitative polymerase chain reaction, CDC25A cell division cycle 25A, KDM2B lysine demethylase 2B, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse