Skip to main content

Table 1 DNA primers for qRT-PCR analyses of gene expression

From: Molecular and cellular characterization of two patient-derived ductal carcinoma in situ (DCIS) cell lines, ETCC-006 and ETCC-010

Target Gene Forward primer Reverse primer
BIRC5 ACCGCATCTCTACATTCAAG CAAGTCTGGCTCGTTCTC
CCNB1 CCAAATCAGACAGATGGAAAT GCCAAAGTATGTTGCTCGA
ESR1 CCACCAACCAGTGCACCATT GTCTTTCCGTATCCCACCTTTC
GSTM1 CTATGATGTCCTTGACCTCCACCGTA ATGTTCACGAAGGATAGTGGGTAGCT
HER2 TCCTGTGTGGACCTGGATGAC CCAAAGACCACCCCCAAGA
MK167 CCACACTGTGTCGTCGTTTG CCGTGCGCTTATCCATTCA
MYBL2 AAAACAGTGAGGAGGAAC CAGGGAGGTCAAATTTAC
STK15 GGAGAGCTTAAAATTGCAGATTTT GCTCCAGAGATCCTTCTCAT
PR TACCCGCCCTATCTCAACTACCTG GGACACCATAATGACAGCCTGATG
UBC TCGAGAATGTCAAGGCAAAGATC GAGTGGACTCTTTCTGGATGTTGTA