Skip to main content

Table 2 Primer properties for the amplification of genes of interest [22]

From: AXL receptor tyrosine kinase: a possible therapeutic target in acute promyelocytic leukemia

Gene/ Primer Sequence GC% Annealing Temperature
GAPDH-Forward CCTGCACCACCACTGCTTA 57.8% 59.9 °C
GAPDH-Reverse CATGAGTCCTTCCACGATACCA 50.0% 59.5 °C
AXL-Forward GTCGGACCACTGAAGCTACC 60.0% 60.1 °C
AXL-Reverse CATCGTCTTCACAGCCACCT 55.0% 60 °C
c-myc-Forward CAGCGACTCTGAGGAGGAAC 60.0% 59.8 °C
c-myc-Reverse TCGGTTGTTGCTGATCTGTC 50.0% 58.2 °C
AXIN2-Forward TCAAGTGCAAACTTTCGCCAACC 47.8% 62.8 °C
AXIN2-Reverse TAGCCAGAACCTATGTGATAAGG 43.4% 57.0 °C
HIF1α-Forward CAGATCTCGGCGAAGTAAAG 50.0% 60.4 °C
HIF1α-Reverse TCACAGAGGCCTTATCAAGATG 45.5% 60.8 °C