Skip to main content

Table 3 List of any cancer (and breast cancer) related genes and unique variants identified by individual patients in the BC-TC group. The strength of known association of each variant with oncogenesis is marked as known (**), potential (*) or no (no marker)

From: Co-occurrence of thyroid and breast cancer is associated with an increased oncogenic SNP burden

TC-BC patients (no. of SNPs) Gene (known breast cancer gene) SNP Effect of mutation *- potential **- known association
T + 1 (4) POLE c.1738C > A p.His580Asn*
BUB1 c.677C > T p.Ala226Val*
WRN c.355 + 4G > C intronic*
ERCC2 c.545C > T p.Ala182Val*
T + 2 (4) SMARCA4 c.918G > C p.Gln306His*
TSC1 c.3109_3110insGCA p.Gly1037_Ser1038insSer*
BIVM-ERCC5,ERCC5 c.1954C > G, c.592C > G p.Pro652Ala, p.Pro198Ala*
NBN c.511A > G p.Ile171Val*
T + 3 (5) ATR c.2924 T > C p.Leu975Ser*
KIT c.2695A > G p.Met899Val*
BMPR1A c.563G > A p.Arg188His*
PALB2 c.522A > G p.(=)*
HOXB13 c.251G > A p.Gly84Glu**
T + 4 (3) BRCA1 c.3925A > C p.Asn1309His*
CDKN2A c.-15_8delGGCGGCGGGGAGCAGCATGGAGCC p.Glu2_Pro3del**
CDK4 c.625C > T p.Arg209Cys
T + 5 (5) SMAD4 c.845A > C p.His282Pro*
XPC c.155C > T p.Ser52Leu*
VPS45 c.566A > G p.Glu189Gly*
FANCM c.527C > T p.Thr176Ile
ATM c.4388 T > G p.Phe1463Cys
T + 6 (4) ATR c.4357A > G p.Ile1453Val*
ATM c.8983C > A p.Leu2995Ile*
BRCA2 c.8755-1G > A intronic**
BRCA1 c.692C > T p.Thr231Met*
T + 7 (6) MUTYH c.1276C > T p.Arg426Cys
ATR c.4912C > T p.Gln1638Ter**
ATR c.1546A > G p.Thr516Ala*
NSD1 c.3805 T > C p.Ser1269Pro*
BRCA2 c.6968A > G p.His2323Arg*
CHEK2 c.614C > T p.Thr205Ile*
T + 8 (4) ATR c.3424A > G p.Ser1142Gly*
PDGFRA c.842C > T p.Thr281Met*
TINF2 c.488C > G p.Pro163Arg*
FLCN c.592G > A p.Asp198Asn
T + 9 (1) TERT c.1234C > T p.His412Tyr
T + 10 (6) TSC2 c.3820 T > C p.Ser1274Pro*
FANCI c.2011A > G p.Ile671Val
FANCI c.2604A > C p.Glu868Asp
MFSD3 c.1033C > T p.Arg345Cys*
BRCA2 c.1483G > C p.Ala495Pro*
BRCA2 c.4409_4410delTA p.Ile1470fs**
T + 11 (2) PTCH1 c.4324C > T p.Arg1442Trp
CDH1 c.32 T > C p.Leu11Pro*
T + 12 (5) PMS1 c.2783 T > C p.Leu928Pro*
ATM c.1273G > A p.Ala425Thr*
ATM c.1300C > T p.Pro434Ser*
BRCA2 c.9038C > T p.Thr3013Ile
STK11 c.413A > G p.Glu138Gly*
T + 13 (2) MUTYH c.536A > G p.Tyr179Cys**
SLX4 c.2359G > A p.Glu787Lys
T + 14 (3) FANCG c.634G > A p.Ala212Thr*
CHEK2 c.1556G > T p.Arg519Leu*
KIF1B c.2680G > A p.Val894Met*
T + 15 (2) RECQL c.1360C > T p.Arg454Cys*
CHEK2 c.444 + 1G > A intronic**
T + 16 (4) TSC1 c.2418G > A p.Met806Ile*
POLD1 c.835_837delGAG p.Glu279del*
PDGFRA c.1099G > A p.Val367Met*
DIS3L2 c.1447C > G p.Arg483Gly*
T + 17 (3) RECQL4 c.3062G > A p.Arg1021Gln
SLX4 c.3890G > A p.Gly1297Glu
SLX4 c.179A > C p.Gln60Pro
T + 18 (4) MSH6 c.3226C > T p.Arg1076Cys**
ATM c.7290 T > G p.His2430Gln*
MAX c.25G > T p.Val9Leu*
BRCA1 c.181 T > G p.Cys61Gly**
T + 19 (0)