Skip to main content

Table 1 Primers used for detection of gene mutation

From: Mutational profiles of marker genes of cervical carcinoma in Bangladeshi patients

Target Gene Primer Sequence Amplicon Size (bp) GC%
PIK3CA_1 F AGACAATGAATTAAGGGAAAATGAC 690 32%
R GTTATACCACTCTTCATATAGCTCA   36%
PIK3CA_2 F AGTGGGGTAAAGGGAATCAAAAGA 533 41.7%
R GCAATTCCTATGCAATCGGTCT   45.5%
EGFR F ACGAAGCCTGTGTGTTTGGT 588 50%
R GGCAAAGGGAGTGGAAGGAA   55%
KRAS_1 F CTTAAGCGTCGATGGAGGAGT 545 52.4%
R ACCCTGACATACTCCCAAGGA   52.%
KRAS_2 F TGTCCGTCATCTTTGGAGCA 549 50%
R TTTCAATCCCAGCACCACCA   50%
  1. (R = Reverse primer, F=Forward primer. Suffix with an underscore after the gene name indicates primer set number)