Skip to main content

Table 1 The primer sequences used for gene PCR

From: The impact of ICAM-1, CCL2 and TGM2 gene polymorphisms on differentiation syndrome in acute promyelocytic leukemia

SNP ID Primer sequences Product size (bp)
rs5498 F inner GAGCACTCAAGGGGAGGTCACCCTCG G allele (189)
rs7270785 F inner CTTATCTCAAACCATAACCAACCTGCACC T allele (201)
rs1024611 F outer GGCTGAGTGTTCACATAGGCTTCTGAGT Control band (281)
  1. F Forward, R Reverse