Skip to main content

Table 1 Primers for qPCR detection

From: Ubiquitin-specific protease-44 inhibits the proliferation and migration of cells via inhibition of JNK pathway in clear cell renal cell carcinoma

Gene nameForward primer (Human)Reverse primer (Human)
USP44AAACGATTCAGGTGGTCAGGAGTGTACCCAGAACCCTCCT
P21TGGAGACTCTCAGGGTCGAAATTCCTCTTGGAGAAGATCAGCC
CyclinD1CAGATCATCCGCAAACACGCAGGCGGTAGTAGGACAGGAA
MMP2CCGTCGCCCATCATCAAGTTCCGCATGGTCTCGATGGTAT
MMP9TTTGAGTCCGGTGGACGATGTTGTCGGCGATAAGGAAGGG
β-ACTINCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT