Skip to main content

Table 1 Primers used in RT-qPCR

From: MiR-200c/FUT4 axis prevents the proliferation of colon cancer cells by downregulating the Wnt/β-catenin pathway

Gene Forward (5′-3′) Reverse (5′-3′)
MiR-200c CCTATGTAAACAGCCTCGACTG CTGGCGTATCGTGAGTCG
U6 GACCTCTATGCCAACACAGT AGTACTTGCGCTCAGGAGGA
FUT4 AAGGTCCAGGCCCACTGAAG CAGTTCAGGTGACAGAGGCTCA
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA