Skip to main content

Table 1 Primer sequences used in RT-qPCR

From: microRNA-451a promoter methylation regulated by DNMT3B expedites bladder cancer development via the EPHA2/PI3K/AKT axis

Targets Forward (5′-3′) Reverse (5′-3′)
miR-451a ACACTCCAGCTGGGAAACCGTTACCATTAC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTTACAG
DNMT3B TAACAACGGCAAAGACCGAGGG TCCTGCCACAAGACAAACAGCC
EPHA2 ACTGCCAGTGTCAGCATCAACC GTGACCTCGTACTTCCACACTC
U6 AAAGCAAATCATCGGACGACC GTACAACACATTGTTTCCTC
GAPDH CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG
  1. Note: RT-qPCR quantitative reverse transcriptase-PCR, miR microRNA, DNMT3B DNA methyltransferase 3B, EPHA2 erythropoietin-producing hepatocellular receptor tyrosine kinase class A2, GAPDH glyceraldehyde-3-phosphate dehydrogenase