Skip to main content

Table 2 Sequences of luciferase reporter plasmid construct

From: miR-203 inhibits cell proliferation and ERK pathway in prostate cancer by targeting IRS-1

Primer Sequence
IRS-1 site A F 5′-TCTAGAGACCTCAGCAAATCCTCTTCTA-3’
IRS-1 site A R 5′-TCTAGAAAGGTTGAAGATGAAGTTTATGC-3’
IRS-1 site B F 5′-TCTAGAGCTGGTTTTGATGGTGGCA-3’
IRS-1 site B R 5′-TCTAGAAACGCTGTGAGAGGTTGGTG-3’
IRS-1-site A-Mut1 5′- CGATGCATCAGATCTCGTTTGT − 3’
IRS1-site A-Mut2 5′- ACAAACGAGATCTGATGCATCG − 3’
IRS1-site A-Del1 5′-GTACGATGCATCGTTTGTTTAC-3’
IRS1-site A-Del2 5′-GTAAACAAACGATGCATCGTAC-3’
IRS1-site B-Mut1 5′-GGCTTTTATCAGATCTCAAGCA-3’
IRS1-site B-Mut2 5′- TGCTTGAGATCTGATAAAAGCC −3’
IRS1-site B-Del1 5′-CTTTTATCAAGCATTTGTAGGCCA-3’
IRS1-site B-Del2 5′-TGGCCTACAAATGCTTGATAAAAG-3’