Skip to main content

Table 2 List of primers for apoptotic genes

From: Status of kinases in Epstein-Barr virus and Helicobacter pylori Coinfection in gastric Cancer cells

S.No. Gene name Forward Primer Reverse Primer
1. PARP1 GGCGATCTTGGACCGAGTAG AGCTTCCCGAGAGTCAGGAT
2. APAF1 CTTGCTGCCCTTCTCCATGA TTGCGAAGCATCAGAATGCG
3. FASR CCTGCCAAGAAGGGAAGGAG TTTGGTGCAAGGGTCACAGT
4. BID CTGCAGGCCTACCCTAGAGA GTGTGACTGGCCACCTTCTT
5. BIK ACCTGGACCCTATGGAGGAC CTGAGGCTCACGTCCATCTC
6. BIM CTTCCATGAGGCAGGATGAA TCCAATACGCCGCAACYCYY
7. BAX CATGGGCTGGACATTGGACT AAAGATGGTCACGGTCTGCC
8. NOXA CAAGAACGCTCAACCGAGCC GCCGGAAGTTCAGTTTGTCTC
9. FAS GGACCCTCCTACCTCTGGTT GCCACCCCAAGTTAGATCTGG
10. FADD CACCAAGATCGACAGCATCG AGATTCTCAGTGACTCCCGC
11. BAK GGTTTTCCGCAGCTACGTTT TAGCGTCGGTTGATGTCGTC
12. CASPAS9 TGCTCAGACCAGAGATTCGC TCTTTCTGCTCGACATCACCAA
13. 16s RNA (H.pylori) CTGGAGAGACTAAGCCCTCC ATTACTGACGCTGATTGCGC