Skip to main content

Table 1 list of primers used with their primer sequences

From: Status of kinases in Epstein-Barr virus and Helicobacter pylori Coinfection in gastric Cancer cells

S.No. Gene name Forward primer Reverse primer
1. EPHB6 ATGAAGTGCCCTCTGCTGTC CTGCCTGGTCATAGTAGCGG
2. MAPK1 AACAGGCCCATCTTTCCAGG CCAGAGCTTTGGAGTCAGCA
3. SRC ACATCCCCAGCAACTACGTG CAGTAGGCACCTTTCGTGGT
4. AKT3 ACCGCACACGTTTCTATGGT TTCATGGTGGCTGCATCTGT
5. JAK2 TGGGGTTTTCTGGTGCCTTT TAGAGGGTCATACCGGCACA
6. PAK1 ACAGGAGGTGGCCATTAAGC CACAGCTGCAATTTGGCCTT
7. PAK2 ATTGGACAAGGGGCTTCTGG CCACATCAGTGAGTGACCCC
8. ERBB2 CGCTGAACAATACCACCCCT GCCAGCTGGTTGTTCTTGTG
9. FGFR2 CCAACTGCACCAACGAACTG ACTGTTCGAGAGGTTGGCTG
10. METMET GTCCTGCAGTCAATGCCTCT GTCAGCCTTGTCCCTCCTTC
11. PDK1 AAGTTCATGTCACGCTGGGT GCATCTGTCCCGTAACCCTC
12. ROR2 ACGTACGCATGGAACTGTGT CGGCACATGCAAACCAAGAA
13. ERBB4 ACAGGGGGCAAACAGTTTCA AGCCCACCAATTACTCCAGC
14. FYN CTCAGCACTACCCCAGCTTC AGGTCCCCGTATGAGACGAA
15. ITK ATTATCTACGCACCCAGCGG ATGCCCTCACACACATCCAG
16. TYK2 CCCATGGCTTGGAAGATGGT ACTCAGCTTGATGAAGGGGC
17. YES 1 GCTCCTGAAGCTGCACTGTA GCATCCTGTATCCTCGCTCC
18. EPHA4 AAGGCTATCGGTTACCCCCT CTTCAAGCTGTTGGGGTTGC
19. MERTK GCCCCATCAGTAGCACCTTT TGCACGTAGCATTGTGGACT
20. TYRO3 CAAACTGCCTGTCAAGTGGC CCCGCCAATGAGGTAGTTGT
21. BRAF AGAGGCGTCCTTAGCAGAGA ATCGGTCTCGTTGCCCAAAT
22. MTOR TCGCTGAAGTCACACAGACC CTTTGGCATATGCTCGGCAC
23. RAF1 AATCAGCCTCACCTTCAGCC AAAGAGCCTGACCCAATCCG
24. FGFR4 GAGTCTCGTGATGGAGAGCG AGTTATAGCGGATGCTGCCC