Skip to main content

Table 1 Primer sequences used for qRT-PCR in this study

From: MEIS1 promotes expression of stem cell markers in esophageal squamous cell carcinoma

Gene Forward primer Reverse primer Amplicon size
MEIS1 ATGACACGGCATCTACTCGTTC TGTCCAAGCCATCACCTTGCT 105
BMI1 CGTGTATTGTTCGTTACCTGGAGAC CATTGGCAGCATCAGCAGAAGG 204
SALL4 CCAGGGAATGACGAGGTGG GAACTCCGCACAGCATTTCTC 96
KLF4 TCTTCTCTTCGTTGACTTTG GCCAGCGGTTATTCGG 210
OCT4 GAACATGTGTAAGCTGCGGCC CCCTTCTGGCGCCGGTTAC 148
HIWI ATGATTGAAGTGGATGACAGAACTG TACTTGACAACAGACAGACAACTAT 97
GAPDH GGAAGGTGAAGGTCGGAGTCA GTCATTGATGGCAACAATATCCACT 101
NANOG GGCAATGGTGTGACGCAGAAGGC GCTCCAGGTTGAATTGTTCCAGGTC 137
PLK1 ATAGAGCGTGACGGCACTGAGT TGCTCGCTCATGTAATTGCG 107