Skip to main content

Table 1 Primers sequence

From: Long non-coding RNA SNHG3 promotes breast cancer cell proliferation and metastasis by binding to microRNA-154-3p and activating the notch signaling pathway

Sequence Forward Reverse  
SNHG3 TTCAAGCGATTCTCGTGCC AAGATTGTCAAACCCTCCCTGT  
LNC00680 TTCGGTCTCTTCGACGACG TGCGAACTCTTGGTGTAGGTC  
AC017048.4 CAGCAGAGGAAGACCATGTG GGCGTTTGGAGTGGTAGAAA  
miR181A2HG TTGCTGGCGTCTCGGTTAAT GCCACCACACTGCCATATCT  
AC007461.2 AACGCTT CACGAATTTGCGT CTCGCTTCGGCAGCACA  
LNC00277 CACGGGGGGCATTTGGAGATTTT GCCACCACACTGCCATATCT  
GATA3-AS1 CGAGTCGGGTTCTGATCCAC GGATGCTGCTTTCCACCCAT  
AC017048.3 AGGGGCCTTCCAGATTAAGG CGAGTCGGGTTCTGATCCAC  
miR-154-3p GTGGTACTTGAAGATAGGTT TTGGTACTGAAAAATAGGTC  
Notch1 GTCAACGCCGTAGATGACC TTGTTAGCCCCGTTCTTCAG  
Notch2 TCCACTTCATACTCACAGTTGA TGGTTCAGAGAA AACATACA  
Notch3 GGGAA AAAGGCAATAGGC GGAGGGAGAAGCCAAGTC  
GAPDH GAAGAGAGAGACCCTCACGCTG ACTGTGAGGAGGGGAGATTCAGT  
  1. Note: SNHG3 Small nucleolar RNA host gene 3, LNC Long non-coding, miR microRNA; GAPDH Glyceraldehyde-3-phosphate dehydrogenase