Skip to main content

Table 3 Primer sequences, accession numbers, fluorescence capture of the genes analysed

From: TIMP-2 regulates proliferation, invasion and STAT3-mediated cancer stem cell-dependent chemoresistance in ovarian cancer cells

Name Primer sequences (5' - 3') Accession number Fluorescence capture (°C)
18S rRNA F GTAACCCGTTGAACCCCATT
R CCATCCAATCGGTAGTAGCG
NR_003286.1 78
TIMP-1 F TGACATCCGGTTCGTCTACA
R GTTTGCAGGGGATGGATAAA
NM_003254.2 85
TIMP-2 F CCGCAACAGGCGTTTTGCAA
R TCACTTCTCTTGATGCAGGC
NM_003255.4 85
TIMP-3 F TTCTGCAACTCCGACATCGT
R ATGCAGGCGTAGTGTTTGGA
NM_000362.4 83
ERCC1 F TTGTCCAGGTGGATGTGAAA
R GCTGGTTTCTGCTCATAGGC
NM_202001.2 83
TUBB3 F GGCCTTTGGACATCTCTTCA
R ATACTCCTCACGCACCTTGC
NM_006086.3 88
CD44 F CCAATGCCTTTGATGGACCA
R TGTGAGTGTCCATCTGATTC
NM_000610.3 81
OCT4A F CTCCTGGAGGGCCAGGAATC
R CCACATCGGCCTGTGTATAT
NM_002701.4 88
PROM1/ CD133 F ATTGGCATCTTCTATGGTTT
R GCCTTGTCCTTGGTAGTGT
NM_006017 78
EpCAM F CGTCAATGCCAGTGTACTTCAGTTG
R TCCAGTAGGTTCTCACTCGCTCAG
NM_002354.2 80
MMP14/ MT1-MMP F GCTCCGAGGGGAGATGTTTG
R CAGCTCCTTAATGTGCTTGGG
NM_002428 83
MMP-2 F TTGACGGTAAGGACGGACTC
R ACTTGCAGTACTCCCCATCG
NM_004530.4 81
E-CAD/ CDH1 F GGCACAGATGGTGTGATTACAG
R GTCCCAGGCGTAGACCAAGAAA
NM_004360.3 75
N-CAD/ CDH2 F AAACAGCAACGACGGGTTAG
R CTTAGGATTGGGGGCAAAAT
NM_001792.3 78
VIM F CCTACAGGAAGCTGCTGGAA
R GGTCATCGTGATGCTGAGAA
NM_003380.3 75
COL12A1 F ACCTGTCACTGTTCGGGAAG
R TGAGGGAAGTGCTGGTCTCT
NM_080645.2 80