Skip to main content

Table 1 Primers used in RT-qPCR

From: Roles of DANCR/microRNA-518a-3p/MDMA ceRNA network in the growth and malignant behaviors of colon cancer cells

Gene Forward (5′-3′) Reverse (5′-3′)
DANCR CTGCATTCCTGAACCGTTATCT GGGTGTAATCCACGTTTCTCAT
MDM2 GACCGAGTCTTGCTCTGTTACCC GAGCGTGTCTTGCTCTCTTTCCC
GAPDH CCCTGCTCTGGTTTGGTGAG GAAGGCGTCTGAGGACTTAAA
MiR-518a ACAGGCCGGGACAAGTGCAATA GCTGTCAACGATACGCTACGTAACG
U6 AACGCTTCACGAATTTGCGT CTCGCTTCGGCAGCACA
LINC005369 TCAGGATTCAGTTTCAGATCAG CATTTCCAATAGTCAGCTAAGG
PCYT1B-AS1 GGTGAACTGAAATGTTAGCCCAG AGGAGATTTGTTTGGCGTGC
LINC-PINT GGTGAACTGAAATGTTAGCCCAG GATTGGCTACCCAACTGTTG
MIR4438-2HG CAGGGGCAGCAGCCACAAA TAGGCGGTTGAATGAGAGG
\