Skip to main content

Table 2 Primers sequences used for qPCR

From: The oncogene Gankyrin is expressed in testicular cancer and contributes to cisplatin sensitivity in embryonal carcinoma cells

GeneForward PrimerReverse Primer
BAI1CTAAGATGGCGAAGGTGGAGCTGTGGGATGAGACGGATGT
BAXGAGGATGATTGCCGCCGTGGACAGGTGGGGGAGGAGGCTTGAGG
FASTGCACCCGGACCCAGAATACGAAGACAAAGCCACCCCAAGTTAG
GankyrinATGAGGCTACAGCAATGCACTACTTGCTCCTTGGGACACC
KI67GAGGTGTGCAGAAAATCCAAACTGTCCCTATGACTTCTGGTTGT
P21CTGGCTCTTGATACCCCCCTTCAACACTGAGACGGGCTCC
PAI1TGCTGGTGAATGCCCTCTACTCGGTCATTCCCAGGTTCTCTA
PCNAACACGATTGGCCCTAAAGTCTTCCCGACCACTCTGCTACGCCTGCAACCG
POU5F1CTTCTGCTTCAGGAGCTTGGGAAGGAGAAGCTGGAGCAAA
RPS20AACAAGCCGCAACGTAAAATCACGATCCCACGTCTTAGAACC
SRYACAGTAAAGGCAACGTCCAGATCTGCGGGAAGCAAACTGC
TP53TCCACTACAACTACATGTGTAACGTGAAATATTCTCCATCCAGTG