Skip to main content

Advertisement

Table 2 Primer sequences of qRT-PCR validation

From: Genome-wide expression profiling in colorectal cancer focusing on lncRNAs in the adenoma-carcinoma transition

 Forward primerReverse primer
CCAT1TCACTGACAACATCGACTTTGAAGGGAGAAAACGCTTAGCCATACAG
UCA1AATGCACCCTAGACCCGAAATCACAGGGGTTACAATGGCT
LINC00261AATAAATGCGGGGATGCCTCCTGGGAAGCCTAGGTCTGTT