Skip to main content

Advertisement

Table 2 Primer sequences for qRT-PCR

From: Plasma expression of miRNA-21, − 214, −34a, and -200a in patients with persistent HPV infection and cervical lesions

Gene Primer sequence
miRNA-21 5′-UAGCUUAUCAGACUGAUGUUGA − 3’
miRNA-214 5′-ACAGCAGGCACAGACAGGCAGU − 3’
miRNA-34a 5′-UGGCAGUGUCUUAGCUGGUUGU −3’
miRNA-200a 5′-UAACACUGUCUGGUAACGAUGU −3’
miRNA-2911 5′-GGCCGGGGGACGGGCUGGGA − 3’
miRNA-let7g 5′-UGAGGUAGUAGUUUGUACAGUU − 3’
miRNA-let7d 5′-AGAGGUAGUAGGUUGCAUAGUU − 3’
miRNA-let7i 5′-UGAGGUAGUAGUUUGUGCUGUU − 3’
miRNA-u6 5′-GTGCTCGCTTCGGCAGCACATATACTAAAA TTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT −3’