Skip to main content

Table 2 The primer sequences were used in qRT-PCR

From: PLOD2 contributes to drug resistance in laryngeal cancer by promoting cancer stem cell-like characteristics

Gene F R
PLOD2 CATGGACACAGGATAATGGCTG AGGGGTTGGTTGCTCAATAAAAA
CD44 GAAGATTTGGACAGGACAGGAC CGTGTGTGGGTAATGAGAGGTA
CD133 TTTGGATTCATATGCCTTCTGT CCATTGGCATTCTCTTTGAA
MMP2 TACAGGATCATTGGCTACACACC GGTCACATCGCTCCAGACT
TCF4 CAAGCACTGCCGACTACAATA CCAGGCTGATTCATCCCACTG
SNAIL1 TCGGAAGCCTAACTACAGCGA AGATGAGCATTGGCAGCGAG
β-actin CTCCATCCTGGCCTCGCTGT GCTGTCACCTTCACCGTTCC
MYC GGCTCCTGGCAAAAGGTCA CTGCGTAGTTGTGCTGATGT
NANOG TTTGTGGGCCTGAAGAAAACT AGGGCTGTCCTGAATAAGCAG
ABCG2 CAGGTGGAGGCAAATCTTCGT ACCCTGTTAATCCGTTCGTTTT
KLF4 CCCACATGAAGCGACTTCCC CAGGTCCAGGAGATCGTTGAA
OCT4 CAAAGCAGAAACCCTCGTGC TCTCACTCGGTTCTCGATACTG
GAPDH TCCTCTGACTTCAACAGCGACAC CACCCTGTTGCTGTAGCCAAATTC