Skip to main content

Table 1 Overview of all recurrently mutated genes (mutated in at least 3 patients)

From: Targeted sequencing of circulating cell-free DNA in stage II-III resectable oesophageal squamous cell carcinoma patients

Gene

Patient ID

CDS mutation

Amino Acid change

CADD Score

MAF

tumour DNA

Pre-cfDNA

Post-cfDNA

WBC

TP53

ESCC01

c.1036G > T

p.Glu346*

44

24.9%

2.2%

c.673-2A > G

.

23

43.9%

2.3%

ESCC02

c.733G > A

p.Gly245Ser

35

43.0%

c.839G > C

p.Arg280Thr

33

20.2%

ESCC03

c.614A > G

p.Tyr205Cys

24

73.7%

ESCC04

c.223_229delCCTGCAC

p.Pro75fs

20

76.1%

1.7%

ESCC05

c.364_365insT

p.Thr123fs

35

85.2%

ESCC06

c.551_554delATAG

p.Asp184fs

33

10.7%

ESCC07

c.920-1G > T

.

25

14.4%

NA

ESCC08

c.770_782 + 10delTGGAAGACTCCAGGTCAGGAGCC

p.Leu257fs

33

18.3%

0.9%

ESCC09

c.643A > G

p.Ser215Gly

29

29.3%

2.3%

ESCC10

c.481G > A

p.Ala161Thr

27

66.2%

2.8%

ESCC11

c.844C > T

p.Arg282Trp

33

27.1%

NA

ESCC13

33

21.9%

ESCC12

c.643A > C

p.Ser215Arg

27

27.9%

ESCC14

c.742C > T

p.Arg248Trp

34

27.3%

0.9%

c.818G > A

p.Arg273His

27

15.0%

NOTCH1

ESCC01

c.4672dupG

p.Leu1559fs

35

57.6%

4.9%

c.1070 T > C

p.Phe357Ser

29

13.6%

2.1%

ESCC02

c.1359_1361delCAA

p.Asn454del

19

62.7%

ESCC05

c.867_868insC

p.Gln290fs

29

83.2%

ESCC08

c.928G > A

p.Gly310Arg

27

26.8%

0.6%

ESCC09

c.4646G > T

p.Cys1549Phe

29

27.6%

1.8%

KMT2D

ESCC02

c.12823C > T

p.Gln4275*

41

43.8%

c.14119C > G

p.Pro4707Ala

18

20.3%

ESCC05

c.636delA

.

1

30.4%

ESCC08

c.9730delG

p.Glu3244fs

35

13.5%

KMT2C

ESCC04

n.-1G > A

.

6

19.5%

ESCC11

c.569G > A

p.Arg190Gln

24

15.2%

NA

ESCC14

c.11953G > A

p.Gly3985Arg

24

12.7%

0.6%

0.4%

CDKN2A

ESCC09

c.316 + 1G > T

.

27

28.8%

2.6%

c.172C > T

p.Arg58*

35

27.0%

1.8%

ESCC10

35

65.5%

1.4%

ESCC14

c.488G > A

p.Arg163Gln

34

42.6%

ETV6

ESCC01

c.329-72C > T

.

4

21.1%

ESCC04

c.464-2686G > C

.

2

36.2%

0.6%

ESCC10

c.164-14646G > A

.

2

20.3%

0.7%

  1. * Nonsense