Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Overview of all recurrently mutated genes (mutated in at least 3 patients)

From: Targeted sequencing of circulating cell-free DNA in stage II-III resectable oesophageal squamous cell carcinoma patients

Gene Patient ID CDS mutation Amino Acid change CADD Score MAF
tumour DNA Pre-cfDNA Post-cfDNA WBC
TP53 ESCC01 c.1036G > T p.Glu346* 44 24.9% 2.2%
c.673-2A > G . 23 43.9% 2.3%
ESCC02 c.733G > A p.Gly245Ser 35 43.0%
c.839G > C p.Arg280Thr 33 20.2%
ESCC03 c.614A > G p.Tyr205Cys 24 73.7%
ESCC04 c.223_229delCCTGCAC p.Pro75fs 20 76.1% 1.7%
ESCC05 c.364_365insT p.Thr123fs 35 85.2%
ESCC06 c.551_554delATAG p.Asp184fs 33 10.7%
ESCC07 c.920-1G > T . 25 14.4% NA
ESCC08 c.770_782 + 10delTGGAAGACTCCAGGTCAGGAGCC p.Leu257fs 33 18.3% 0.9%
ESCC09 c.643A > G p.Ser215Gly 29 29.3% 2.3%
ESCC10 c.481G > A p.Ala161Thr 27 66.2% 2.8%
ESCC11 c.844C > T p.Arg282Trp 33 27.1% NA
ESCC13 33 21.9%
ESCC12 c.643A > C p.Ser215Arg 27 27.9%
ESCC14 c.742C > T p.Arg248Trp 34 27.3% 0.9%
c.818G > A p.Arg273His 27 15.0%
NOTCH1 ESCC01 c.4672dupG p.Leu1559fs 35 57.6% 4.9%
c.1070 T > C p.Phe357Ser 29 13.6% 2.1%
ESCC02 c.1359_1361delCAA p.Asn454del 19 62.7%
ESCC05 c.867_868insC p.Gln290fs 29 83.2%
ESCC08 c.928G > A p.Gly310Arg 27 26.8% 0.6%
ESCC09 c.4646G > T p.Cys1549Phe 29 27.6% 1.8%
KMT2D ESCC02 c.12823C > T p.Gln4275* 41 43.8%
c.14119C > G p.Pro4707Ala 18 20.3%
ESCC05 c.636delA . 1 30.4%
ESCC08 c.9730delG p.Glu3244fs 35 13.5%
KMT2C ESCC04 n.-1G > A . 6 19.5%
ESCC11 c.569G > A p.Arg190Gln 24 15.2% NA
ESCC14 c.11953G > A p.Gly3985Arg 24 12.7% 0.6% 0.4%
CDKN2A ESCC09 c.316 + 1G > T . 27 28.8% 2.6%
c.172C > T p.Arg58* 35 27.0% 1.8%
ESCC10 35 65.5% 1.4%
ESCC14 c.488G > A p.Arg163Gln 34 42.6%
ETV6 ESCC01 c.329-72C > T . 4 21.1%
ESCC04 c.464-2686G > C . 2 36.2% 0.6%
ESCC10 c.164-14646G > A . 2 20.3% 0.7%
  1. * Nonsense