Regulation of human chorionic gonadotropin beta subunit expression in ovarian cancer

BMC Cancer

Table 2 Primers (5′ → 3′) and hydrolysis probes for RT-qPCR with the use of SYBR Green and TaqMan assays

	Gene	Forward primer	Reverse primer	Hydrolysis probe
SYBR Green	SP1	tgaaggaaggggctcggggg	ccaggggcaaagtgcccaca	n/a
	SP3	caggatgtggtaaagtctatgg	cttctcacctgtatgtgttcttc	n/a
	TFAP2A	gctgcctcaccagctgtcgg	acagggacacggggcctttct	n/a
	HPRT	tgaagagctattgtaatgaccagt	caaatccaacaaagtctggc	n/a
TaqMan	CGB1–2 ^a	ggtccgctgactcyggc ^b	cagcagcagcccctttgac	6FAM-tcactccctgtctcactcccccacg-BBQ
	CGB3–9 ^a	gtgtcsagctcacyccagcatccta ^b	agcagcccctggaacatct	6FAM-ccgaggtytaaagccaggtacacsaggc-BBQ
	HPRT	Human HPRT Gene Assay Cat. No. 05 046 157 001 (Roche Diagnostics, Mannheim, Germany)

^a CGB3–9 and CGB1–2 hydrolysis probes were designed and manufactured by Tib Molbiol (Berlin, Germany); ^b degenerated base code: S-G/C; Y-C/T

ISSN: 1471-2407