Skip to main content

Advertisement

Table 2 Primer in this study

From: Knockdown of YAP inhibits growth in Hep-2 laryngeal cancer cells via epithelial-mesenchymal transition and the Wnt/β-catenin pathway

Gene Forward Reverse
YAP GAACAATGACGACCAATAGCTC TAGTCCACTGTCTGTACTCTCA
DKK1 TACCAGACCATTGACAACTACC TCCATTTTTGCAGTAATTCCCG
GSK-3β AGGAGAACCCAATGTTTCGTAT ATCCCCTGGAAATATTGGTTGT
β-catenin TGGATTGATTCGAAATCTTGCC GAACAAGCAACTGAACTAGTCG
vimentin ATGTCCACCAGGTCCGTGT TTCTTGAACTCGGTGTTGATGG
E-cadherin AGTCACTGACACCAACGATAAT ATCGTTGTTCACTGGATTTGTG
GAPDH GTATCGTGGAAGGACTCATGAC ACCACCTTCTTGATGTCATCAT