Skip to main content

Advertisement

Table 1 shRNA sequences for YAP.

From: Knockdown of YAP inhibits growth in Hep-2 laryngeal cancer cells via epithelial-mesenchymal transition and the Wnt/β-catenin pathway

Sequences
shRNA1 GCTGATGGTTTATGCCACAAGTTGA
 Top strand GATCCGCTGATGGTTTATGCCACAAGTTGATTCAAGAGATCAACTTGTGGCATAAACCATCAGCTTTTTTC
 Bottom strand AATTGAAAAAAGCTGATGGTTTATGCCACAAGTTGATCTCTTGAATCAACTTGTGGCATAAACCATCAGCG
shRNA2 GTCACCGAGATCTTCGGGCTGCTAAT
 Top strand GATCCGTCACCGAGATCTTCGGGCTGCTAATTTCAAGAGAATTAGCAGCCCG AAGATCTCGGTGATTTTTTC
 Bottom strand AATTGAAAAAATCACCGAGATCTTCGGGCTGCTAATTCTCTTGAAATTAGCA GCCCGAAGATCTCGGTGACG
NC-shRNA TTCTCCGAACGTGTCACGTAA
 Top strand GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATT TTTTC
 Bottom strand AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAG AACG
cDNA
 YES1-F CGAATTCCCCCGGGCGGGATCCGCCACCATGGGCTGCATTAAAAGTA
 YES1-R CGGCCGCTACGCGTCGGGGTACCTAAATTTTCTCCTGGCTGGTACT