Skip to main content

Table 3 miRNAs used for qPCR validation of microarray data

From: Expression-based decision tree model reveals distinct microRNA expression pattern in pediatric neuronal and mixed neuronal-glial tumors

No miRNA Sequence Assay symbol
Differential Expression
 1 miR-155-5p UUAAUGCUAAUCGUGAUAGGGGU 204,308
 2 miR-4754 AUGCGGACCUGGGUUAGCGGAGU 2,107,017
 3 miR-4530 CCCAGCAGGACGGGAGCG 2,105,012
 4 miR-628-3p UCUAGUAAGAGUGGCAGUCGA 206,057
 5 let-7b-3p CUAUACAACCUACUGCCUUCCC 205,653
 6 miR-4758-3p UGCCCCACCUGCUGACCACCCUC 2,118,014
 7 miR-891a-5p UGCAACGAACCUGAGCCACUGA 204,220
 8 miRPlus-A1086 UAGUGCCGUGGUCCUUUUGGC 169,416
Stable Expression
 1 miR-500a-5p UAAUCCUUGCUACCUGGGUGAGA 204,794
 2 miR-451b UAGCAAGAGAACCAUUACCAUU 2,103,713
 3 miR-514b-3p AUUGACACCUCUGUGAGUGGA 2,108,297
 4 miR-1293 UGGGUGGUCUGGAGAUUUGUGC 2,110,424
 5 miR-1226-3p UCACCAGCCCUGUGUUCCCUAG 2,102,736