Skip to main content

Table 2 Sequences of primers employed for PCR amplification of bisulfite-treated DNA

From: High methylation levels of PCDH10 predict poor prognosis in patients with pancreatic ductal adenocarcinoma

gene Amplicon (bp) CpG n. Sequence 5′- 3′
PCDHAC2 235 11 f.aggggtttgattgttttttttagat
r.actcaacaaatcctactctaattc
PCDHGC5 290 14 f.gggtatggtgttatttagtttaat
r.ccaaactctaaaatcactataatat
PCDH10 196 16 f. ggttagggaggatggatgtaagtat
r. cccaccatactaaattaaaccactaat