Skip to main content

Table 1 Primers used for quantitative RT-PCR experiments

From: Salinomycin triggers endoplasmic reticulum stress through ATP2A3 upregulation in PC-3 cells

Gene name Forward primer (5′ → 3′) Reverse primer (5′ → 3′) Product size (bp)
MAGEA3 TCGGTGAGGAGGCAAGGTTC CGGGAGTGTGGGCAGGAG 123
ATP2A3 CTCTGACTTGCCTGGTGGAGA GGTGAACTCCTTCCGCATCA 122
NPY1R CCTTTGTGAGGTGTTTGTGGG TGAAGCTAGGAAGAGACGCC 116
BTBD15 ACGAGTGCAAAACATGTGGCG GCCTTTGGAGTGGTACTGTGAA 242
HSD17B12 GGAGCAGCGCCTATTAGTGT CGAAATACGCAGGGCTAGGT 189
IPF1 GAATGGCTTTATGGCAGATTA TGATACTGGATTGGCGTTGT 191
BGN CGGACACACCGGACAGATAG AAAGGACACATGGCGCTGTA 293
GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA 131