Skip to main content

Table 3 The identified HPV-HPV junction positions and sequence reads in the tumors containing the deleted HPV populations

From: Whole genome sequencing reveals complexity in both HPV sequences present and HPV integrations in HPV-positive oropharyngeal squamous cell carcinomas

Tumor HPV-HPV junction positions in HPV16 genome Deleted length (nt) Deleted viral genes Identified HPV-HPV junction sequence
683 501 --- 6984 6447 E1a, E2, E4, E5, L2, L1, URRa AGTATAGTGGTGGAAGTGGGGGGGGTGTGCAAACCGTTTT
601 6204 --- 3689 5391 L2a, E6, E7, URR, E1, E2, E4, E5 TTCCTTTAGGACGCAAATTTTTACTACAAGCAGGATTGAA
711 1865 --- 7037 5172 E1a, E2, E4, E5, L2, L1, URRa GACGTGGTCCAGATTAAGTTTACTAAACTACAATAATTCA
568 6680 --- 6924 244 URRa TAAACTTGTACGTTTCCTGCAGTTCATACATGAACTGTGT
515 1221 --- 7062 5841 E1a, E2, E4, E5, L2, L1, URRa TTGTAAAGGATTGTGCAACACTAAGGGCGTAACCGAAATCGGT
532 1091 --- 6897 5806 E1a, E2, E4, E5, L2, L1, URRa TCACAGATGGTACAATGGGCTTCTAAGGCCAACTAAATGT
676 5852 ---6002 150 L1a TACATATAAAAATACTAACTGGAATTTTGGTCTACAACCT
624 6967 --- 1493 2452 URRa, E6, E7, E1a TAAATGTCACCCTAGTTCATACATGAACTGTGTAAAGGTT
  1. aindicates that only partial deletion was found in that viral gene