Skip to main content

Table 1 The sequence of primers and probes used for genes expression

From: HTLV-1-host interactions on the development of adult T cell leukemia/lymphoma: virus and host gene expressions

Targeted gene Sequence 5’3’ Purpose Product length (bp)
AKT1 5’-GTGTCAGCCCTGGACTACC-3′
5’-CAGCCCGAAGTCTGTGATCTTA-3’
FAM-TCCTTGTCCAGCATGAGGTTCTCCAGC-BHQ
Forward
Reverse
Probe
114
BAD 5’-GACGAGTTTGTGGACTCCTTTAAG-3′
5’-CCTGCCCAAGTTCCGATCC-3’
FAM-TCCTCGCCCGAAGAGCGCGG-BHQ
Forward
Reverse
Probe
129
RORγt 5’-GCTAGGTGCAGAGCTTCAGG-3′
5’-TGTTCTCATGACTGAGCCTTGG-3’
FAM-CCTTGGCTCCCTGTCCTTCTCAGCA-BHQ
Forward
Reverse
Probe
145
FOXP3 5′- ACTACTTCAAGTTCCACAACATGC -3′
5′- GAGTGTCCGCTGCTTCTCTG-3’
FAM- TCACCTACGCCACGTTCATCCGCT -BHQ
Forward
Reverse
Probe
95
IFNλ3 5’-GTGGCTTTGGAGGCTGAG-3′
5’-GCTGGTCCAAGACATCCC-3’
FAM-TTCTGGAGGCCACCGCTGAC-BHQ
Forward
Reverse
Probe
91
HBZ 5’-AGAACGCGACTCAACCGG-3′
5’-TGACACAGGCAAGCATCGA-3’
FAM-TGGATGGCGGCCTCAGGGCT-BHQ
Forward
Reverse
Probe
133
β2M 5’-TTGTCTTTCAGCAAGGACTGG-3′
5’-CCACTTAACTATCTTGGGCTGTG-3’
FAM-TCACATGGTTCACACGGCAGGCAT-BHQ
Forward
Reverse
Probe
127