Skip to main content

Table 1 RT-PCR primer sequences used in microRNAs validation

From: microRNAs expression profile related with response to preoperative radiochemotherapy in patients with locally advanced gastric cancer

microRNAs primer sequences
miR-142-5p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGTAGTGC
miR-142-5p F ACACTCCAGCTGGGcataaagtagaaagcac
miR-142-3p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCATAAA
miR-142-3p F ACACTCCAGCTGGGtgtagtgtttcctacttta
miR-338-3p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAACAAAA
miR-338-3p F ACACTCCAGCTGGGtccagcatcagtgatttt
miR-340-5p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAATCAGTC
miR-340-5p F ACACTCCAGCTGGGttataaagcaatgagact
miR-16-2-3p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAAAGCAG
miR-16-2-3p F ACACTCCAGCTGGGccaatattactgtgctgc
hsa-miR-582-5p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGTAACTG
hsa-miR-582-5p F ACACTCCAGCTGGGttacagttgttcaaccagt
hsa-u6 CTCGCTTCGGCAGCACA
hsa-u6 AACGCTTCACGAATTTGCGT