Skip to main content

Table 1 The primer sequences and PCR conditions

From: The hypermethylation of p16 gene exon 1 and exon 2: potential biomarkers for colorectal cancer and are associated with cancer pathological staging

Primer name Forward primersa (5′-3′) Reverse primersa(5′-3′) Anneal temp. Product
p16 exon 1
 Outer TTAGAGGATTTGAGGGATAGGGT TACAAACCCTCTACCCACCTAAAT 56 °C 324 bp
 Inner GGATTTGAGGGATAGGGT CCCTCTACCCACCTAAAT 56 °C 313 bp
p16 exon 2
 Outer TGGTAGGTTATGATGATGGGTAG ATCCTCACCTAAAAAACCTTCC 54 °C 321 bp
 Inner GGTTATGATGATGGGTAG TTACTACCTCTAATACCCC 53 °C 273 bp
  1. aSequence differences between modified primers according bisulfite-converted DNA and unconverted DNA are indicated in boldface type