Skip to main content

Table 1 Primer sequences for RT-qPCR analysis; clone ID and catalog numbers for shRNAs (Open Biosystems); antibodies used

From: Interleukin 8 is a biomarker of telomerase inhibition in cancer cells

Application Gene symbol Forward primer (5′-3′) Reverse primer (5′-3′)
RT-qPCR IL8 taaaaagccaccggagcact atcaggaaggctgccaagag
actin gccgggacctgactgactac tcttctccagggaggagctg
Gene symbol Clone ID Catalog number
shRNAs IL8 TRCN0000058028 RHS3979–9625212
  TRCN0000058030 RHS3979–9625214
Antibodies Protein Source Dilution
IL8 Santa Cruz Biotechnology 1:500 dilution
GFP Santa Cruz Biotechnology 1:500 dilution
Actin Cell Signaling 1:1000 dilution
Inhibitor Concentration Source  
Imetelstat 2.5 μM Geron Corporation  
Mismatch Oligonucleotide 2.5 μM Geron Corporation