Table 1 Primer sequences for RT-qPCR analysis; clone ID and catalog numbers for shRNAs (Open Biosystems); antibodies used
From: Interleukin 8 is a biomarker of telomerase inhibition in cancer cells
Application | Gene symbol | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|---|
RT-qPCR | IL8 | taaaaagccaccggagcact | atcaggaaggctgccaagag |
actin | gccgggacctgactgactac | tcttctccagggaggagctg | |
Gene symbol | Clone ID | Catalog number | |
shRNAs | IL8 | TRCN0000058028 | RHS3979–9625212 |
|  | TRCN0000058030 | RHS3979–9625214 | |
Antibodies | Protein | Source | Dilution |
IL8 | Santa Cruz Biotechnology | 1:500 dilution | |
GFP | Santa Cruz Biotechnology | 1:500 dilution | |
Actin | Cell Signaling | 1:1000 dilution | |
Inhibitor | Concentration | Source | Â |
Imetelstat | 2.5 μM | Geron Corporation |  |
Mismatch Oligonucleotide | 2.5 μM | Geron Corporation |  |