Skip to main content

Table 1 List of primers

From: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer

S.No Oligos Sequence (5′-3′)
1 ERRβ Promoter F ACAGGTACCTTGTACTCCAGTCTGGGCGA
2 ERRβ Promoter R ACACTCGAGATGTCCCTGACCACACCTCT
3 RT-ERα F AGCTCCTCCTCATCCTCTCC
4 RT-ERα R TCTCCAGCAGCAGGTCATAG
5 RT-ERRβ F CTATGACGACAAGCTGGTGT
6 RT-ERRβ R CCTCGATGTACATGGAATCG
7 RT-p21cip F GAGGCCGGGATGAGTTGGGAGGAG
8 RT-p21cip R CAGCCGGCGTTTGGAGTGGTAGAA
9 RT-GAPDH F AAGATCATCAGCAATGCCTC
10 RT-GAPDH R CTCTTCCTCTTGTGCTCTTG
11 ERRβ EMSA Site 1F GGACAAAAATAAGGTCAAGTTTCTTTGTTA
12 ERRβ EMSA Site 1R TAACAAAGAAACTTGACCTTATTTTTGTCC
13 ERRβ EMSA Site 2F ATTTAATGAGACAGGTCATTCATTCAGTCA
14 ERRβ EMSA Site 2R TGACTGAATGAATGAATGACCTGTCTCATTAAAT
15 ERRβ chip ERE Site 1F CCAGTCTGGGCGACAAGAGTGAAACTC
16 ERRβ chip ERE Site 1R CCATTACAGTGGATTGTGGAG
17 ERRβ chip ERE Site 2F CTCCACAATCCACTGTAATGG
18 ERRβ chip ERE Site 1R CCAACTACCAGGAGAATAGGAGCAC