Skip to main content

Table 1 Forward and reverse primer used for the detection of the respective microsatellites

From: Microsatellite instability testing in colorectal cancer using the QiaXcel advanced platform

Microsatellite Forward-primer Reverse-primer
BAT 25 TCGGCTCCAAGAATGTAAGT TCTGCATTTTAACTATGGCTC
BAT 26 TGACTACTTTTGACTTCAGCC AACCATTCAACATTTTTAACCC
BAT 40 GTAGAGCAAGACCACCTTG ATTAACTTCCTACACCACAAC
D2s123 AAACAGGATGCCTGCCTTTA GGACTTTCCACCTATGGGAC
D10s197 GTGATACTGTCCTCAGGTCTCC ACCACTGCACTTCAGGTGAC
D13s153 AGCATTGTTTCATGTTGGTG CAGCAGTGAAGGTCTAAGCC
D17s250 GGAAGAATCAAATAGACAAT GCTGGCCATATATATATTTAAACC
D18s58 GCAGGAAATCGCAGGAACTT GCTCCCGGCTGGTTTT
D5s346 ACTCACTCTAGTGATAAATCG AGCAGATAAGACAGTATTACTAGTT
MycI CCTTTTAAGCTGCAACAATTTC TGGCGAGACTCCATCAAAG