Skip to main content

Table 1 All 5′ primers contain a SacI and all 3′ primers a BglII site for cloning into pGl3-P vector

From: Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the CALB2 promoter

Name BRE 5′ primer (5′-3′) 3′ primer (5′-3′) size (bp)
7–13 GATGAGCTCATGCGAAAGTGAAGGTGGTCCCCAG TGAAGATCTAGCAAGGAGGAACTGGAGATGTCA 1278
9–13 GAGCTCTCGAACCTCTCTTTCCTATCTC AGATCTAGCAAGGAGGAACTGGAGATGTCA 695
10–13 GAGCTCTGGAGCTGAGCCTGGAGAGAAG AGATCTAGCAAGGAGGAACTGGAGATGTCA 530
12–13 GAGCTCTAGGCCATCAGACAGCTCTGAG AGATCTAGCAAGGAGGAACTGGAGATGTCA 127
9 GAGCTCTCGAACCTCTCTTTCCTATCTC AGATCTCTTCTCTCCAGGCTCAGCTCCA 189
9–10 GAGCTCTCGAACCTCTCTTTCCTATCTC AGATCTCCCTCATCTCTCCTTGCAGCT 253
9–11 GAGCTCTCGAACCTCTCTTTCCTATCTC AGATCTAGGCCCTCAAATTCCTCAGAG 348