Skip to main content

Advertisement

Table 2 The primers for real-time PCR and semi-quantitative RT-PCR used in this study

From: The oncogenic effects of HES1 on salivary adenoid cystic carcinoma cell growth and metastasis

Gene Accession no. Forward Reverse
ACTB NM 001101 CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATACT
HES1 NM 005524.3 AGGCGGACATTCTGGAAATG CGGTACTTCCCCAGCACACTT
NOTCH1 NM 017617.3 GGAAGTTGAACGAGCATAGTCC GCATGATGCCTACATTTCAAGA
CCND1 NM 053056.2 CCCCGCACGATTTCATTGAACA CATGGAGGGCGGATTGGAAATG
Ki67 NM 002417.4 GCTCCCCACCTCAGAGAGTTTT CTCTTAAGGGAGGGCTTGCAGA
KRT14 NM 000526.4 GAGCCGCATTCTGAACGAGATG ACTGCAGCTCAATCTCCAGGTT
IGFBP7 NM 001553.2 GATGCTGGAGAATATGAGTGCC CCATGACTACTTTTAACCATGCA
PSCA NM 005672.4 CCAGGTGAGCAACGAGGACT TAGTCCTGTGAGTCATCCACGC
S100A2 NM 005978.3 ATAAATCCTCACCCTGGGAGCC CCCTCTTGGCAGGAGTACTTGT
C9ORF3 NM 032823.5 TCTGCGGAAGTGGTGACCC AGGGTCCAGCTGTATGTCCATG
MMP9 NM 004994.2 GAGGCGCTCATGTACCCTATGT GGTGTGGTGGTGGTTGGAGG