Skip to main content

Table 1 Primers used in the study

From: BB-Cl-Amidine as a novel therapeutic for canine and feline mammary cancer via activation of the endoplasmic reticulum stress pathway

Species Gene Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′)
Canine RPL32 TTGAAGTGCTGCTGATGTGC GGGATTGGTGACTCTGATGG
Feline RPL17 AAGAACACACGGGAAACTGC CTGGGCACACCTACCAACTC
Canine PAD2 AGCAAGCGGATCACCATC ATGTCACGGTTCCAGTCCAG
Feline PAD2 CAGCAAGCGAATCACCATC AGGATGTCACGGTTCCAGTC
Canine PAD4 GTCGGGAGGAAGAAGTACCC CATCTCCTGGCTCTCCTTG
Feline PAD4 AGGACGTTCTGTCCAACGAG GCTTTAACACCTCCCGGTTC
Canine ERα AGGAAGAATGTTGAAACACAAAC AGCAAGTTAGGAGCAAAGAAGAG
Feline ERα ATGTTGCTGGCTACGTCATCTC GGTCCTTCTCTTCCAGAGACTTC
Canine DDIT3 AGCTGGAAGCCTGGTATGAG CAGTCAGCCAAGCCAGAGAG
Feline DDIT3 AGCTGGAAGCCTGGTATGAG CAGAGAGGCAGGGTCAAGAG
Canine DDIT4 CTGGACAGCAGCAACAGTG CATCAGGTTGGCACACAAG
Feline DDIT4 CTGGACAGCAGCAACAGTG GCACACAAGTGCTCATCCTC