Skip to main content

Table 1 Primers used for qRT-PCR, qCHIP and siRNAs oligonucleotides

From: Up-regulation of ceRNA TINCR by SP1 contributes to tumorigenesis in breast cancer

Primers used for qRT-PCR
TINCR-F TGTGGCCCAAACTCAGGGATACAT
TINCR-R AGATGACAGTGGCTGGAGTTGTCA
GAPDH-F GCTCTCTGCTCCTCCTGTTC
GAPDH-R ACGACCAAATCCGTTGACTC
siRNAs/shRNA oligonucleotides
scrambled UUCUCCGAACGUGUCACGUdTdT
si-SP1–1 CAGCGUUUCUGCAGCUACCUUGACU
si-SP1–2 GACAGGUCAGUUGGCAGACUCUACA
siTINCR-1 UAUUCCUUCAGCCAGUACCCAGGUC
siTINCR-2 UUUCCAAGGUGGCACAGUGCUUUCC
qCHIP analysis of the TINCR promoter for SP1 occupancy
BS3-F TGACCTCGCTGATGGCTCT
BS3-R TCAGGCGTCCGCTCCCCACT
BS1/2-F TGAGGGGACCGTGGCA
BS1/2-R TGGTAGCGCTTCCAGCGCGACA