Skip to main content

Table 1 Primers list

From: MiR-30a-5p confers cisplatin resistance by regulating IGF1R expression in melanoma cells

Primer name Sequence (5′ to 3′)
has-miR-10b-5p-F GCCATTACCCTGTAGAACCG
has-miR-10b-5p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAA
has-miR-1246-F CGGGAGAATGGATTTTTGG
has-miR-1246-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCTGCT
has-miR-138-5p-F GCGAAGCTGGTGTTGTGAA
has-miR-138-5p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGGCCT
has-miR-146a-5p-F CGGCGGCTGAGAACTGAAT
has-miR-146a-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA
has-miR152-3p-F CGGCTCAGTGCATGACAGA
has-miR152-3p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCAAGT
has-miR-15a-3p-F CCGTCCAGGCCATATTGTG
has-miR-15a-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGAGGC
has-miR-181a-3p-F CAGCACCATCGACCGTTGA
has-miR-181a-3p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGTACA
has-miR-181a-5p-F GACGCAACATTCAACGCTG
has-miR-181a-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCAC
has-miR-182-5p-F CGGATTTGGCAATGGTAGA
has-miR-182-5p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGTGTG
has-miR-193a-5p-F ATCTATGGGTCTTTGCGGG
has-miR-193a-5p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATCT
has-miR-210-3p-F CAGTGGCTGTGCGTGTGAC
has-miR-210-3p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAGCC
has-miR-21-3p-F ACGGCACCAACACCAGTCG
has-miR-21-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCC
has-miR-301a-3p-F AGGCGGCAGTGCAATAGTA
has-miR-301a-3p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGCTTTG
has-miR-30a-5p-F TGCCGTGTAAACATCCTCG
has-miR-30a-5p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTTCCA
has-miR-449b-3p-F GCGTCAGCCACAACTACCC
has-miR-449b-3p-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGTGGC
has-miR-454-5p-F CAGCGGCACCCTATCAATA
has-miR-454-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCAGAG
has-miR-4701-3p-F CCAGATGGGTGATGGGTGT
has-miR-4701-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACACCA
URP-1 GTGTCGTGGAGTCGGCAA
URP-2 CGCAGGGTCCGAGGTATTC
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
IGF1R-F GGCTGGGGCTCTTGTTTACC
IGF1R-R GCCTCTCTCGAGTTCGCC
GAPDH-F TCCAAAATCAAGTGGGGCGA
GAPDH-R TGATGACCCTTTTGGCTCCC
TuD-miR-30a-5p-R CGCGAAAAAAGACGGCGCTAGGATCATCTTGTGTAAACATCAGATCTCGACTGGAAGGTTGTATTCTGTGACCAGAATACTTGTGTAAACATCAGATCTCGACTGGAAGGTTGATGATCCTAGCGCCGTCG
IGF1R-wt-F AATTCTAGCGATCGCTCGAG TCGCACTCGTCAGTTGTCAGTT
IGF1R-wt-R ATTTTATTGCGGCCAGCGGCCGCATCCTTTTTTGGCATATTGTAAAGC
IGF1R-mut A-F CGAAGATCTGCAAATGTAGAACTAATTAAATGTTTCATTGCATTT
IGF1R-mut A-R ACATTTGCAGATCTTCGTCAACTGACTACCCG
IGF1R-mut B-F GACACCACAAATGTAGCTAGCTTTACAATATGCCAAAAA
IGF1R-mut B-R GCTACATTTGTGGTGTCCTAAAAAAAAAAAAAAAAAA