Skip to main content

Table 1 Sequences of primers for real-time PCR

From: Compound A attenuates toll-like receptor 4-mediated paclitaxel resistance in breast cancer and melanoma through suppression of IL-8

Gene Accession no. Primer (5′-- > 3′) Size (bp)
ACTB NM_001101.3 F CACACTGTGCCCATCTACGA 162
R CTCCTTAATGTCACG CACGA
TLR4 NM_138554 F TCACAGAAGCAGTGAGGATGAT 140
R AAGTAATATTAGGAACCACCTCCA
MyD88 NM_002468 F TGCAGAGCAAGGAATGTGAC 153
R GGTTGGTGTAGTCGCAGACA
IL-6 NM_000600 F CGGGAACGAAAGAGAAGCTCTA 68
R GGCGCTTGTGGAGAAGGAG
IL-8 NM_000584 F GCCAACACAGAAATTATTGTAAAGCTT 112
R AATTCTCAGCCCTCTTCAAAAACTT
XIAP NM_001167 F CCATGGCAGATTATGAAGCA 176
R TTGTTCCCAAGGGTCTTCAC