Skip to main content

Table 1 Primers used for LAMP amplification of OPSCC specimens (5′ to 3′)

From: Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification

HPV 16a F3 TCGGTTGTGCGTACAAAG
B3 AGCCTCTACATAAAACCATCC
FIP TGGGGCACACAATTCCTAGT*CACACACGTAGACATTCGT
BIP TCAGAAACCATAATCTACCATGGC*ATTACATCCCGTACCCTCTT
LF CCCATTAACAGGTCTTCCAAAGT
LB CCTGCAGGTACCAATGGGG
HPV 18a F3 AACGACGATTCCACAACA
B3 CAACCGGAATTTCATTTTGG
FIP GTCTTTCCTGTCGTGCTCGGT*AGCTGGGCACTATAGAGG
BIP CGACGCAGAGAAACACAAGT*CTCTAAATGCAATACAATGTCTTG
LF CAGCACGAATGGCACTGG
LB TATTAAGTATGCATGGACCTAAGGC
HPV 31 F3 AGAAGAAAAACAAAGACATTTGG
B3 CTCCTCATCTGAGCTGTC
FIP GTCTTCTCCAACATGCTATGCA*GAAACGATTCCACAACATAGG
BIP GAGAAACACCTACGTTGCAAGA*GGGTAATTGCTCATAACAGTG
LF ACGTCCTGTCCACCTTCCT
LB TGTGTTAGATTTGCAACCTGAGGCA
HPV 35 F3 TGCATGGAGAAATAACTACATTG
B3 CGCCTCACATTTACAACAG
FIP TGTCACACAATTGCTCATAACAGTA*CAAGACTATGTTTTAGATTTGGAAC
BIP GCTCAGAGGAGGAGGAAGATAC*GACGTTACAATATTATAATTGGAGG
LF TATTGACGGTCCAGCTGGACAA
LB GGACAAGCAAAACCAGACA
  1. * denotes a TTTT linker
  2. aSaetiew et al. 2011