Skip to main content

Table 1 Primer sequences, product size, MgCl2 concentration and annealing temperatures used in RT-PCR analyses

From: In vitro and in silico validation of CA3 and FHL1 downregulation in oral cancer

Gene Primer sequence (5′-3′) Product size (bp) MgCl2 (mM) Annealing temperature (°C)
CA3 F: TGAAGCAGCGCGATGGGAT
R: GTCAGAGCTCACGGTCATGGGC
260 2 66
FHL1 F: CCGCTTCTGGCATGACACCT
R: ACGGTCCCCTTGTACTCCACG
189 2 66
ANXA6 F: -CCGGCACAGATGAAAAGGCTC
R: TTCTCCTCCCTCCTCACGATGC
191 2 66
WDR26 F: TGCCAATTGCGGAGCTGACA
R: CGTCTGCTCCAAATTCACCATCAA
196 2 66
HMGN4 F: CCTTCCCTCGCCTTCCTGTTCC
R: TGTCCTCCTCACGCTGTTCCTGG
182 1 66
C9orf64 F: AGGCTCTTTTCTCAACTGCGTCCGT
R: AGCAGCCATCTCCTTTTCCTTCCA
191 2 66
FSTL1 F: CCCAGACCCAGACAGAGGAGGAG
R: ACTGGTGATTTGGCGACTGTAGCA
203 2 66
CCN1 F: GCAATTCAGAGGATCCATG
R: GGTGTGCTTGAGGGGACGGTAG
220 3 55
SAR1B F: ACCACGAAAGGCTGTTAGAGTCAAAA
R: AACCAAACATCTCTCGCAACCTCTC
146 2 66
NFE2L1 F: ACGGAACCTGCTAGTGGATGGAGA
R: CTGTTATGCTGGAAATGTCTGCTGGA
167 1 70