Skip to main content

Advertisement

Table 1 Primer sequences, product size, MgCl2 concentration and annealing temperatures used in RT-PCR analyses

From: In vitro and in silico validation of CA3 and FHL1 downregulation in oral cancer

Gene Primer sequence (5′-3′) Product size (bp) MgCl2 (mM) Annealing temperature (°C)
CA3 F: TGAAGCAGCGCGATGGGAT R: GTCAGAGCTCACGGTCATGGGC 260 2 66
FHL1 F: CCGCTTCTGGCATGACACCT R: ACGGTCCCCTTGTACTCCACG 189 2 66
ANXA6 F: -CCGGCACAGATGAAAAGGCTC R: TTCTCCTCCCTCCTCACGATGC 191 2 66
WDR26 F: TGCCAATTGCGGAGCTGACA R: CGTCTGCTCCAAATTCACCATCAA 196 2 66
HMGN4 F: CCTTCCCTCGCCTTCCTGTTCC R: TGTCCTCCTCACGCTGTTCCTGG 182 1 66
C9orf64 F: AGGCTCTTTTCTCAACTGCGTCCGT R: AGCAGCCATCTCCTTTTCCTTCCA 191 2 66
FSTL1 F: CCCAGACCCAGACAGAGGAGGAG R: ACTGGTGATTTGGCGACTGTAGCA 203 2 66
CCN1 F: GCAATTCAGAGGATCCATG R: GGTGTGCTTGAGGGGACGGTAG 220 3 55
SAR1B F: ACCACGAAAGGCTGTTAGAGTCAAAA R: AACCAAACATCTCTCGCAACCTCTC 146 2 66
NFE2L1 F: ACGGAACCTGCTAGTGGATGGAGA R: CTGTTATGCTGGAAATGTCTGCTGGA 167 1 70