Skip to main content

Table 1 List of primers used for qPCR analysis

From: Optimising the chick chorioallantoic membrane xenograft model of neuroblastoma for drug delivery

Gene Gene name Forward 5′-3′ Reverse 5′-3′
UBC ubiquitin C ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGGT
HPRT1 hypoxanthine phosphoribosyltransferase 1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT
GAPDH glyceraldehyde-3-phosphate dehydrogenase AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA
ROBO2 roundabout, axon guidance receptor, homolog 2 GATGTGGTGAAGCAACCAGC TGGCAGCACATCTCCACG
STMN4 stathmin-like 4 CCTAGCAGAGAAACGGGAACA GGCGTGCTTGTCCTTCTCTT
KLF4 Kruppel-like factor 4 CGCCGCTCCATTACCAAGAGC
CGGTCGCATTTTTGGCACTG
CGGTCGCATTTTTGGCACTG
MYCN Neuroblastoma-derived v-myc avian myelocytomatosis viral related oncogene CACAAGGCCCTCAGTACCT ACCACGTCGATTTCTTCCTCT