Skip to main content

Table 2 Primers used for RT-qPCR

From: Regulation of pancreatic stellate cell activation by Notch3

Primer Forward sequence 5′-3’ Reverse sequence 5′-3’
Notch1 TCGTGCTCCTGTTCTTTGTG CTCTCCGCTTCTTCTTGCTG
Notch2 GCAGGAGCAGGAGGTGATAG ATGAGAAGCCAGGAGAGCAG
Notch3 TGGCTATGCTGGTGACAGTT AGGGGGACAGGAACAGAGAT
Notch4 AATGCCAAGGTCAGGAACAC AGCCCTCATCACACACACAC
α-SMA AATGGCTCTGGGCTCTGTAA CTCTTGCTCTGGGCTTCATC
Fibronectin GAAGTCGCAAGGAAACAAGC GTAGGTGAACGGGAGGACAC
CollagenI TGACTGGAAGAGCGGAGAGT GACGGCTGAGTAGGGAACAC
HES1 GGCGAAGGGCAAGAATAAAT TGCTTCACAGTCATTTCCAGA
GAPDH GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTTCTTACTCC