Skip to main content

Table 1 Primers used for PCR, LOH and bisulfite sequencing analysis

From: Bidirectional alteration of Cav-1 expression is associated with mitogenic conversion of its function in gastric tumor progression

Gene Primer Sequence (5′ to 3′)
Cav1 Cav-1S TCTGGGGCGTCGTGCGCAAA
Cav-1AS GAACCTTGATGAAGCCTGTG
C1⍺A AGTTTTCATCCAGCCACGGG
C1⍺AS TCTTGACCACGTCATCGTTGAG
C1βA CATTTTTCCTCCCACCGCCGTT
C1βAS AAAACTGTGTGTCCCTTCTG
RF2S ATGTATATGTACATCAGGGA
RF2AS CAGGCACATAGCTGGGTACC
SNP-1 GGCTCAACATTGTGTTCCCATTTCAGC
SNP-2 GTGTCAGGAAGACTGGAAGAGGCA
P1 TGTGTATTTTGTAAATATGGTATA
P2 AAGTTAAAGATTTTTATTTTTTATT
Cav2 Cav-2S ATCTGCAGCCATGCCCTCTTTG
Cav-2AS GGGTCCAAGTATTCAATCCTGG
C2⍺A ATGGGGCTGGAGACGGAGAA
C2⍺AS ACTGAAGGCAGAACCATTAGGCA
C2βA TGCGTCCTGTCTCCTCAGCT
C2βAS ACTGAAGGCAGAACCATTAGGCA
GAPDH G2 CATGTGGGCCATGAGGTCCACCAC
G3 AACCATGAGAAGTATGACAACAGC
G5 GAGTCCTTCCACGATACCAAAG