Skip to main content

Table 1 Primer sequences for the genes used in semi-quantitative PCR

From: In vitro characterization of CD133lo cancer stem cells in Retinoblastoma Y79 cell line

S No. Gene Forward primer Reverse primer
1. ACTB atgcagaaggagatcactgc tcatagtccgcctagaagca
2. CD133 cctctggtggggtatttctt aggtgctgttcatgttctcc
3. BMI1 gcttcaagatggccgcttg ttctcgttgttcgatgcatttc
4. NANOG caaccagacccagaacatcc ttccaaagcagcctccaag
5. OCT4 atgcattcaaactgaggtgcctgc ccaccctttgtgttcccaattcct
6. PROX1 caagttgtggacactgtggt gcagactggtcagaggagtt
7. MACC1 cggtcaggaagaattgcac ttaccacgaagggtgaaagc
8. SNAI2 tgtgacaaggaatatgtgagcc tgagccctcagatttgacctg
9. ABCG2 ggaactcagtttatccgtgg cgaggctgatgaatggagaag