Skip to main content

Advertisement

Table 4 Primer sequences and annealing temperatures of genes used in this study

From: Isolation and characterization of three new anti-proliferative Sesquiterpenes from Polygonum barbatum and their mechanism via apoptotic pathway

Gene Sequence Annealing Temperature (°C) References
BCL-2 L1 R: ATGGTCAGTGTCTGGTCATT F: TTGTGGAACTCTATGGGAAC 57 [44]
p53 R: CTCTCGGAACATCTCGAAGCG F: GCTCTGACTGTACCACCATCC 57 [45]
BAX R: GGCCCCAGTTGAAGTTGC F: AAGAAGCTGAGCGAGTGTC 54 [46]
BAK R: CCTGAGAGTCCAACTGCAAA F: GGTCCTGCTCAACTCTACCC 60 [47]
VEGF R: ACCGCCTCGGCTTGTCAC F: GTGTGCCCCTGATGCGATGCG 54 [48]
COX-2 R: CGCTCAGCCATACAGCAAATCCTT F: GTGCACTGTGTTTGGAGTGGGTTT 56 [49]
GAPDH R: GGTCTACATGGCAACTGTGA F: ACGACCACTTTGTCAAGCTC 59 [50]