Skip to main content

Advertisement

Table 4 Primer sequences and annealing temperatures of genes used in this study

From: Isolation and characterization of three new anti-proliferative Sesquiterpenes from Polygonum barbatum and their mechanism via apoptotic pathway

Gene Sequence Annealing Temperature
(°C)
References
BCL-2 L1 R: ATGGTCAGTGTCTGGTCATT
F: TTGTGGAACTCTATGGGAAC
57 [44]
p53 R: CTCTCGGAACATCTCGAAGCG
F: GCTCTGACTGTACCACCATCC
57 [45]
BAX R: GGCCCCAGTTGAAGTTGC
F: AAGAAGCTGAGCGAGTGTC
54 [46]
BAK R: CCTGAGAGTCCAACTGCAAA
F: GGTCCTGCTCAACTCTACCC
60 [47]
VEGF R: ACCGCCTCGGCTTGTCAC
F: GTGTGCCCCTGATGCGATGCG
54 [48]
COX-2 R: CGCTCAGCCATACAGCAAATCCTT
F: GTGCACTGTGTTTGGAGTGGGTTT
56 [49]
GAPDH R: GGTCTACATGGCAACTGTGA
F: ACGACCACTTTGTCAAGCTC
59 [50]