Skip to main content

Table 2 Selected candidate reference genes

From: Endogenous controls of gene expression in N-methyl-N-nitrosourea-induced T-cell lymphoma in p53-deficient mice

Gene symbol Primer sequence (5′ → 3′) Size (bp) Efficiency (%) R2
Gapdh F1 CAGCAACTCCCACTCTTCCAC
R1 TGGTCCAGGGTTTCTTACTC
192 105 0.998
Rn18s F1 GCAATTATTCCCCATGAACG
R1 GGCCTCACTAAACCATCCAA
237 95 0.997
Actb F1 CCTCCCTGGAGAAGAGCTATG
R1 TTACGGATGTCAACGTCACAC
132 101 0.992
B2m F1 CTCGGTGACCCTGGTCTTTC
R1 GGATTTCAATGTGAGGCGGG
170 99 0.998
Hprt F1 AGTCCCAGCGTCGTGATTAG
R1 TGATGGCCTCCCATCTCCTT
164 98 0.997
Rplp0 F1 CTCTCGCTTTCTGGAGGGTG
R1 TCAGTCTCCACAGACAATGCC
172 103 0.994
Gusb F1 TGGGTGTGGTATGAACGGGA
R1 GGTCAGTGTGTTGTTGATGGC
123 98 0.999
Ctbp1 F1 TGCATGGTACAGTGAGCAGG
R1 CTGTAGGCAGCCCCATTGAG
162 105 0.998