Skip to main content

Advertisement

Table 1 Bisulfite sequencing PCR primers and PCR conditions for BAS samples

From: Quantitation of DNA methylation in Epstein-Barr virus–associated nasopharyngeal carcinoma by bisulfite amplicon sequencing

Gene Sequences (5′ to 3′) Product size (bp) Annealing (°C) Annealing Time (s) Position from TSS UCSC gene ID
CR2 F: GGGTGAGTTTGAGTTAAAGAGTGG R: AAAAAACCAATAAAAACAATCAAAACCAAA 514 58 50 −149 – +365 uc001hfv.3
ITGA4 F: TGTAATTTTGGGGTAGTGGT R: CCCTCCTACCTCCTTAAAAAAAAAAAA 362 58 45 +711 − +1072 uc002unu.3
RERG F: GGAGTTTGGAGGTTTGGAAAT R: CAAAAACAAATACCAATAACCC 278 58 45 −145 – +133 uc001rct.3
RRAD F: TTGGTGGGGGTGGATAGATA R-CCTCCCCCAACCCCCAAAT 331 61 45 −102 – +228 uc002eqo.2
SHISA3 F: GGTTGAGAGTTAAGTTTTGGGGG R: CCTCCCCACTCCTCAAAAAAA 446 58 45 −570 – −125 uc003gwp.3
ZNF549 F: TTTTAGTTTGATGGGTTTTTTTTTTTGTT R: AAACCTCAAAACCCAAATAAAAATC 502 56 45 −177 – +325 uc002qpb.2
ZNF671 F: ATTTTGTTTTTGTTAGGTTGTTTTTGG R: CTATCCTAAAACACAAAAACTACAAACACT 311 57 45 +13 − +323 uc002qpz.4
  1. PCR cycles: 40
  2. CR2: complement C3d receptor 2, ITGA4: integrin subunit alpha 4, RERG: RAS-like estrogen regulated growth inhibitor, RRAD: Ras-related glycolysis inhibitor and calcium channel regulator, SHISA3: shisa family member 3, ZNF549: zinc finger protein 549, ZNF671: zinc finger protein 671